View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20261_low_45 (Length: 266)
Name: NF20261_low_45
Description: NF20261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20261_low_45 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 131; Significance: 5e-68; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 117 - 259
Target Start/End: Original strand, 5472708 - 5472850
Alignment:
| Q |
117 |
ttctaacaagcctagggaaagtgatcttagaggtatcatcaaccgatagaatctttaattcttcgaaaggaatgttgtgaaatataagtagatacatatg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5472708 |
ttctaacaagcctagggaaagtgatcttagaggtatcatcaaccgatagaatctttaattcttcgaaaggaatgttgtgaaatataagtagatacatatg |
5472807 |
T |
 |
| Q |
217 |
ttcaaatcaagattgaagtctgtgtgccaatttacagaataat |
259 |
Q |
| |
|
||||||| ||||||||||||| || |||||||||||||||||| |
|
|
| T |
5472808 |
ttcaaatgaagattgaagtctatgagccaatttacagaataat |
5472850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University