View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20261_low_52 (Length: 246)
Name: NF20261_low_52
Description: NF20261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20261_low_52 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 116; Significance: 4e-59; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 79 - 209
Target Start/End: Original strand, 17401550 - 17401681
Alignment:
| Q |
79 |
agcttttctttttatcatgggtatgaaagaaagtgctattctttaggctaataaagcatccttcataatctcttaacagaaccaaacatgg-ccataatg |
177 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||| |
|
|
| T |
17401550 |
agcttttctttttatcatgggtatgaaagaaagtgctattctttaggctaataaagcatccttcataatctcttaacagaaccaaacatggcccatgatg |
17401649 |
T |
|
| Q |
178 |
tgatccaatcattattgtcagtctctgcaaat |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| |
|
|
| T |
17401650 |
tgatccaatcattattgtcagtgtctgcaaat |
17401681 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University