View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20261_low_64 (Length: 235)
Name: NF20261_low_64
Description: NF20261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20261_low_64 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 61; Significance: 3e-26; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 17 - 77
Target Start/End: Complemental strand, 18403914 - 18403854
Alignment:
| Q |
17 |
aatatccacacacaaaaaataccatgtccagcttcactcatgccactacactactccatgc |
77 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18403914 |
aatatccacacacaaaaaataccatgtccagcttcactcatgccactacactactccatgc |
18403854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 166 - 218
Target Start/End: Complemental strand, 18403768 - 18403716
Alignment:
| Q |
166 |
aatagaagaaatttagtttcaacatttctagcaacatcattggttggagtagt |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
18403768 |
aatagaagaaatttagtttcaacatttctagcaacatcaatggttggagtagt |
18403716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University