View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20261_low_67 (Length: 230)
Name: NF20261_low_67
Description: NF20261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20261_low_67 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 113 - 211
Target Start/End: Complemental strand, 55062478 - 55062380
Alignment:
| Q |
113 |
gtgaggcttgtcattttgtccttttatcaacttttgatttattgatatagccattctaagacacacccacattaattagaatttcatttattttcttaa |
211 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55062478 |
gtgaggcttgtcattttgtacttttatcaacttttgatttattgatatagccattctaagacacacccacattaattagaatttcatttattttcttaa |
55062380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 46 - 88
Target Start/End: Complemental strand, 55062553 - 55062511
Alignment:
| Q |
46 |
tcagaattcaaatgtttatataaccgcaaaataacaaactcta |
88 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
55062553 |
tcagaattcaaatgtttataaaaccgcaaaataacaaactcta |
55062511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University