View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20261_low_69 (Length: 225)
Name: NF20261_low_69
Description: NF20261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20261_low_69 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 206
Target Start/End: Complemental strand, 6454761 - 6454556
Alignment:
| Q |
1 |
aatgaagggttgtagtccatctcattcttggagctctaacacttcttttaacaccattaacgactcttgtatttcgcttgaaatcgcggccatagatgtg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6454761 |
aatgaagggttgtagtccatctcattcttggagctctaacacttcttttaacaccattaacgactcttgtatttcgcttgaaatcgcggccatagatgtg |
6454662 |
T |
|
| Q |
101 |
aggttggaagtgttggttaaagtttcttgaaacaccttgaacttgatgacgatgaaggtgatgattatgatgatgtggattcatcaaatctgaatttcca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6454661 |
aggttggaagtgttggttaaagtttcttgaaaccccttgaacttgatgacgatgaaggtgatgattatgatgatgtggattcatcaaatctgaatttcca |
6454562 |
T |
|
| Q |
201 |
aagcct |
206 |
Q |
| |
|
|||||| |
|
|
| T |
6454561 |
aagcct |
6454556 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University