View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20261_low_72 (Length: 211)
Name: NF20261_low_72
Description: NF20261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20261_low_72 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 191
Target Start/End: Complemental strand, 37511784 - 37511594
Alignment:
| Q |
1 |
ttggtttcacggcgagttcgccgccgccaacgcgatcattgatgctctctgtggtcaccttgcgcagattgctccatcctccaacgattacgattcagct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37511784 |
ttggtttcacggcgagttcgccgccgccaacgcgatcattgatgctctctgtggtcaccttgcgcagattgctccatcctccaacgattacgattcagct |
37511685 |
T |
 |
| Q |
101 |
tttacggccgtacaccggcggcggttcaactggatccctgttattcagatgcagaagtatcattctattgctgatgtgactctcgagcttc |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37511684 |
tttacggccgtacaccggcggcggttcaactggatccctgttattcagatgcagaagtatcattctattgctgatgtgactctcgagcttc |
37511594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 79; Significance: 4e-37; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 67 - 193
Target Start/End: Complemental strand, 53753059 - 53752933
Alignment:
| Q |
67 |
gattgctccatcctccaacgattacgattcagcttttacggccgtacaccggcggcggttcaactggatccctgttattcagatgcagaagtatcattct |
166 |
Q |
| |
|
|||||||||||| |||||||||| ||||| |||||||||| |||||||||||||||| ||||||||||||||||||||| |||||| | ||||||||| |
|
|
| T |
53753059 |
gattgctccatcttccaacgattgcgattttgcttttacggtcgtacaccggcggcggctcaactggatccctgttattctgatgcaaaggtatcattcc |
53752960 |
T |
 |
| Q |
167 |
attgctgatgtgactctcgagcttcgt |
193 |
Q |
| |
|
|||| |||||||||||| ||||||||| |
|
|
| T |
53752959 |
attgttgatgtgactcttgagcttcgt |
53752933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 52
Target Start/End: Complemental strand, 40225118 - 40225067
Alignment:
| Q |
1 |
ttggtttcacggcgagttcgccgccgccaacgcgatcattgatgctctctgt |
52 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| ||||| || ||||||||| |
|
|
| T |
40225118 |
ttggtttcacggcgagttcgccgctgccaacgcaatcatcgacgctctctgt |
40225067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 33
Target Start/End: Original strand, 51588092 - 51588124
Alignment:
| Q |
1 |
ttggtttcacggcgagttcgccgccgccaacgc |
33 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |
|
|
| T |
51588092 |
ttggtttcacggcgagttcgccgctgccaacgc |
51588124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University