View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20262_high_110 (Length: 254)
Name: NF20262_high_110
Description: NF20262
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20262_high_110 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 89; Significance: 5e-43; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 144 - 241
Target Start/End: Complemental strand, 34525552 - 34525453
Alignment:
| Q |
144 |
agttttgtatttcatagttgataactctttttataacatat--tttgacaattgatgttcaaaattgtttcttcaattctaaacttctaatgtgattaat |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34525552 |
agttttgtatttcatagttgataactctttttataacatatattttgacaattgatgttcaaaattgtttcttcaattctaaacttctaatgtgattaat |
34525453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 146 - 233
Target Start/End: Complemental strand, 34521933 - 34521844
Alignment:
| Q |
146 |
ttttgtatttcatagttgataactctttttataaca--tattttgacaattgatgttcaaaattgtttcttcaattctaaacttctaatg |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||| | || |||||||||||||| ||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
34521933 |
ttttgtatttcatagttgataactctttttaaaccagatattttgacaattgttgttcaaaattgtatcttcaattctaaatttctaatg |
34521844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University