View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20262_high_111 (Length: 251)
Name: NF20262_high_111
Description: NF20262
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20262_high_111 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 105 - 235
Target Start/End: Complemental strand, 29319832 - 29319702
Alignment:
| Q |
105 |
taccatttacttttgtcctttaaaataaacttcattcatttttctgaaataaaataattaatatgtagaagttaaaatttgaactccagattcttcacta |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
29319832 |
taccatttacttttgtcctttaaaataaacttcattcatttttctgaaataaaataattaatatgtagaagttaaagtttgaactccagattcttcacta |
29319733 |
T |
 |
| Q |
205 |
aatgtgtgtgagttcaaccactaaattattt |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
29319732 |
aatgtgtgtgagttcaaccactaaattattt |
29319702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University