View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20262_high_114 (Length: 250)
Name: NF20262_high_114
Description: NF20262
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20262_high_114 |
 | |
|
| [»] scaffold0636 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0636 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: scaffold0636
Description:
Target: scaffold0636; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 7675 - 7438
Alignment:
| Q |
1 |
cgatcactcagccttgagacatggcatgaccctagtgagtccttggagtctaacccacctaaacttttatcataggaaaaacaattttaaaataaatttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7675 |
cgatcactcagccttgagacatggcatgaccctagtgagtccttggagtctaacccacctaaacttttatcataggaaaaacaattttaaaataaatttg |
7576 |
T |
|
| Q |
101 |
atacaataagaaattagatgaatgtgcttccttctaattaaactataaaataaaagatataggagatagagaagatgacacaatgatgttatcctgcacc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7575 |
atacaataagaaattagatgaatgtgcttccttctaattaaactataaaataaaagatataggagatagagaagatgacacaatgatgttatcctgcacc |
7476 |
T |
|
| Q |
201 |
ctaactgggctagtttagtttccacaaactgtgatatt |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7475 |
ctaactgggctagtttagtttccacaaactgtgatatt |
7438 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 165 - 195
Target Start/End: Complemental strand, 18240781 - 18240751
Alignment:
| Q |
165 |
gatagagaagatgacacaatgatgttatcct |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
18240781 |
gatagagaagatgacacaatgatgttatcct |
18240751 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University