View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20262_high_120 (Length: 243)
Name: NF20262_high_120
Description: NF20262
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20262_high_120 |
 |  |
|
| [»] scaffold0636 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 19 - 224
Target Start/End: Original strand, 16410118 - 16410323
Alignment:
| Q |
19 |
tttctgacaagttttttatagtgttcttcaaaacagggttgtgcaaatgcatagatatccaaggaaacataaattctaaacattagatatgtgttcagaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16410118 |
tttctgacaagttttttatagtgttcttcaaaacagggttgtgcaaatgcatagatatccaaggaaacataaattctaaacattagatatgtgttcagaa |
16410217 |
T |
 |
| Q |
119 |
ggactaaaaaggacttcagattcatatctgatgcaatctcaataacaaataggattgaagaacaacattgaccaagtaagtaggaggtcaaatgcaaatc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16410218 |
ggactaaaaaggacttcagattcatatctgatgcaatctcaataacaaataggattgaagaacaacattgaccaagtaagtaggaggtcaaatgcaaatc |
16410317 |
T |
 |
| Q |
219 |
tcatgt |
224 |
Q |
| |
|
|||||| |
|
|
| T |
16410318 |
tcatgt |
16410323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0636 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0636
Description:
Target: scaffold0636; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 171 - 227
Target Start/End: Original strand, 6566 - 6622
Alignment:
| Q |
171 |
gattgaagaacaacattgaccaagtaagtaggaggtcaaatgcaaatctcatgtcaa |
227 |
Q |
| |
|
||||||||||||| |||||||||| || |||||| ||||| | | |||||||||||| |
|
|
| T |
6566 |
gattgaagaacaagattgaccaagaaaataggagatcaaaagtagatctcatgtcaa |
6622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University