View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20262_high_128 (Length: 229)

Name: NF20262_high_128
Description: NF20262
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20262_high_128
NF20262_high_128
[»] chr4 (1 HSPs)
chr4 (18-217)||(9866155-9866350)


Alignment Details
Target: chr4 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 18 - 217
Target Start/End: Complemental strand, 9866350 - 9866155
Alignment:
18 ataaggggcacataatgaatttaagggtttccataattaatgtttgtaaggtgactagaagaacatatacatttatagcaaaataataatgataattatg 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||    
9866350 ataaggggcacataatgaatttaagggtttccataattaatgtttgtaaggtgactagaagaacatatacatttatagcaaaatgataatgatatttatg 9866251  T
118 tgaaaaatattgtaggtttaatataatttttataaccaaccgacatcagtcttaacaagcatgagtaataataatgtaccaaaaaagcatgagtaatact 217  Q
    ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||   ||||||||||||||||||||||||||||||||    
9866250 tgaaaaatattgtaggtttaatataattttt-taaccaaccgacatcagtcttaacaagcatgag---taataatgtaccaaaaaagcatgagtaatact 9866155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University