View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20262_high_130 (Length: 228)
Name: NF20262_high_130
Description: NF20262
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20262_high_130 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 12 - 212
Target Start/End: Complemental strand, 10311503 - 10311303
Alignment:
| Q |
12 |
gcacagatcaaatccagtccaactgttttatggtgttacaaggacaagcggtatgtaattgatgaatctgtcgtgatttattgatgtattgatttgtttg |
111 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10311503 |
gcacagatcaaatccagcccaactgttttatggtgttacaaggacaagcggtatgtaattgatgaatctgtcgtgatttattgatgtattgatttgtttg |
10311404 |
T |
|
| Q |
112 |
agggatgagtgtttacatgaacttgtttaatatgattttgaatgcagtcatatgaaggaacatgagaagcagattgaaaaattgaggaagaggggtcttt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10311403 |
agggatgagtgtttacatgaacttgtttgatatgattttgaatgcagtcatatgaagaaacatgagaagcagattgaaaaattgaggaagaggggtcttt |
10311304 |
T |
|
| Q |
212 |
t |
212 |
Q |
| |
|
| |
|
|
| T |
10311303 |
t |
10311303 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 18 - 60
Target Start/End: Complemental strand, 38435922 - 38435880
Alignment:
| Q |
18 |
atcaaatccagtccaactgttttatggtgttacaaggacaagc |
60 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||||| |||| |
|
|
| T |
38435922 |
atcaaatccaggccaactgttttatggtgttataaggaaaagc |
38435880 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 13 - 61
Target Start/End: Original strand, 11191723 - 11191771
Alignment:
| Q |
13 |
cacagatcaaatccagtccaactgttttatggtgttacaaggacaagcg |
61 |
Q |
| |
|
|||| |||||||| |||| || ||||| ||||||||||||||||||||| |
|
|
| T |
11191723 |
cacatatcaaatctagtctaagtgtttaatggtgttacaaggacaagcg |
11191771 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University