View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20262_high_134 (Length: 218)
Name: NF20262_high_134
Description: NF20262
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20262_high_134 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 15 - 200
Target Start/End: Complemental strand, 33277238 - 33277054
Alignment:
| Q |
15 |
atgaacgcaaaaacacattgaaaaggggaaataattcaacaattattttatacattccccaatagataaacaaatctaaatctcctaaactgtttaataa |
114 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33277238 |
atgaacacaaaaacacattgaaaaggggaaataattcaacaattattttatacattccccaatagataaacaaatctaaatctcctaaactgtttaataa |
33277139 |
T |
 |
| Q |
115 |
tttaagattacaacaataaacaaaacaaatctagttttgcctataagcaatgtaattagccaaagcaatcaaaggagcagctttat |
200 |
Q |
| |
|
||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
33277138 |
tttaacattacaacaataaacaaaac-aatctagttttgcctataagcaatgtaattagccaaagcaatcaaaggagcagatttat |
33277054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University