View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20262_high_66 (Length: 364)
Name: NF20262_high_66
Description: NF20262
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20262_high_66 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 14 - 347
Target Start/End: Complemental strand, 8361873 - 8361552
Alignment:
| Q |
14 |
cagtttgtccaggggtcgtgtcttgtgctgatatcttggctcttgctgctagggacgctgtcactctggtaagtcacaatcacaaatgatgatatgaatt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8361873 |
cagtttgtccaggggtcgtgtcttgtgctgatattttggctcttgctgctagagacgctgtcactctggtaagtcacaatcacaaatgatgatatgaatt |
8361774 |
T |
|
| Q |
114 |
ttatgataatttaaaggttacgttgcagtaacaattaa---tacattttttgagtgtcatatatgtcattaattagtccggagggccaaattgggaagta |
210 |
Q |
| |
|
|| |||||||||||||| |||||||||| ||| ||||||||||||||||||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
8361773 |
ata--ataatttaaaggtt-----gcagtaacaaataacaatacattttttgagtgtcat----gtcatta----gtccggagggccaaattgggaagta |
8361689 |
T |
|
| Q |
211 |
ccaaaaggaagaaaggatggtataatctcaaaggctactgaaacgagacaattgccagctcccactttcaacatctcccaattacaacaaagcttctctc |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8361688 |
ccaaaaggaagaaaggatggtataatctcaaaggctactgaaacgagacaattgccagctcccactttcaacatctcccaattacaacaaagcttctctc |
8361589 |
T |
|
| Q |
311 |
aaagaggactttccttgcaagatctcgttgccctctc |
347 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8361588 |
aaagaggactttccttgcaagatctcgttgccctctc |
8361552 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 28 - 63
Target Start/End: Original strand, 37111313 - 37111348
Alignment:
| Q |
28 |
gtcgtgtcttgtgctgatatcttggctcttgctgct |
63 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |
|
|
| T |
37111313 |
gtcgtgtcttgtgctgatattttggctcttgctgct |
37111348 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University