View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20262_low_128 (Length: 242)
Name: NF20262_low_128
Description: NF20262
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20262_low_128 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 2 - 218
Target Start/End: Complemental strand, 42168380 - 42168164
Alignment:
| Q |
2 |
tcataaactattttagaatttcgataaattttcaggacaaatatgactattaccannnnnnnnncatgaaacaaaggttcctgcttaatataagcaatac |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
42168380 |
tcataaactattttagaatttcgataaattttcaggacaaatatgactattaccatttttctttcatgaaacaaaggttcctgcttaatataagcaatac |
42168281 |
T |
 |
| Q |
102 |
ttttgatgaaaaattgattcatgaaaataacataggatgagggttcaactaaatccctcaccagtagaccgaaaaagatgtaacgtcgtatttgatcaat |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||| |||||| |||||||||||| |
|
|
| T |
42168280 |
ttttgatgaaaaattgattcatgaaaataacataggatgagggttcaactaaatcccttgcccgtagaccgaaaaagatgcaacgtcatatttgatcaat |
42168181 |
T |
 |
| Q |
202 |
agtcaagattttctatt |
218 |
Q |
| |
|
||||||||||| ||||| |
|
|
| T |
42168180 |
agtcaagatttgctatt |
42168164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University