View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20262_low_139 (Length: 219)
Name: NF20262_low_139
Description: NF20262
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20262_low_139 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 201
Target Start/End: Original strand, 53425245 - 53425445
Alignment:
| Q |
1 |
acatcaacgttcttcacaagtttaccagagattttcaatgaaacagtgaatggaccagattaccctccataccactacgttatgaaagcagatgatgaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
53425245 |
acatcaacgttcttcacaagtttaccagagattttcaatgaaacagtgaatggaccagattaccctccataccactacgttatgaaagcagatgatgata |
53425344 |
T |
|
| Q |
101 |
cctacgtgaggttaaacagtttggtaaaatcgttaaaaccgttaccgaaggaggatttatactatggttttgtgataccgtgtggaagcatggacccttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53425345 |
cctacgtgaggttaaacagtttggtaaaatcgttaaaaccgttaccgaaggaggatttatactatggttttgtgataccgtgtggaagcatggacccttt |
53425444 |
T |
|
| Q |
201 |
t |
201 |
Q |
| |
|
| |
|
|
| T |
53425445 |
t |
53425445 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University