View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20262_low_143 (Length: 215)
Name: NF20262_low_143
Description: NF20262
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20262_low_143 |
 |  |
|
| [»] chr8 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 191; Significance: 1e-104; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 13 - 215
Target Start/End: Original strand, 41071917 - 41072119
Alignment:
| Q |
13 |
aagaatatgatcgaggtggccgtcgtccgaaatttgatggaaaccgtggcaatagatcatcgcaaattgatcatggatttcaaggaagaaatgttgatga |
112 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41071917 |
aagaatacgatcgaggtggccgtcgtccgaaatttgatggaaaccgtggcaatagatcatcgcaaattgatcatggatttcaaggaagaaatgttgatga |
41072016 |
T |
 |
| Q |
113 |
aactggtagagatggtggtcgcagaggcaataaatcttcgcaaattgatcttggatttcagggtagaaattttgatgaaactgatagagatggtggtcgt |
212 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41072017 |
aactggtagagatggtggtcgtagaggcaataaatctttgcaaattgatcttggatttcagggtagaaattttgatgaaactgatagagatggtggtcgt |
41072116 |
T |
 |
| Q |
213 |
cgt |
215 |
Q |
| |
|
||| |
|
|
| T |
41072117 |
cgt |
41072119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 60 - 210
Target Start/End: Original strand, 41072042 - 41072192
Alignment:
| Q |
60 |
ggcaatagatcatcgcaaattgatcatggatttcaaggaagaaatgttgatgaaactggtagagatggtggtcgcagaggcaataaatcttcgcaaattg |
159 |
Q |
| |
|
||||||| ||| | ||||||||||| ||||||||| || |||||| |||||||||||| ||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
41072042 |
ggcaataaatctttgcaaattgatcttggatttcagggtagaaattttgatgaaactgatagagatggtggtcgtcgtggcaataaatcttcgcaaattg |
41072141 |
T |
 |
| Q |
160 |
atcttggatttcagggtagaaattttgatgaaactgatagagatggtggtc |
210 |
Q |
| |
|
|||||||| |||||||||||||| ||| |||||||| |||||||||||||| |
|
|
| T |
41072142 |
atcttggacttcagggtagaaatgttgctgaaactgttagagatggtggtc |
41072192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 57 - 132
Target Start/End: Original strand, 41072117 - 41072192
Alignment:
| Q |
57 |
cgtggcaatagatcatcgcaaattgatcatggatttcaaggaagaaatgttgatgaaactggtagagatggtggtc |
132 |
Q |
| |
|
|||||||||| ||| ||||||||||||| |||| |||| || |||||||||| |||||||| |||||||||||||| |
|
|
| T |
41072117 |
cgtggcaataaatcttcgcaaattgatcttggacttcagggtagaaatgttgctgaaactgttagagatggtggtc |
41072192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 97; Significance: 8e-48; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 22 - 210
Target Start/End: Original strand, 7532094 - 7532282
Alignment:
| Q |
22 |
atcgaggtggccgtcgtccgaaatttgatggaaaccgtggcaatagatcatcgcaaattgatcatggatttcaaggaagaaatgttgatgaaactggtag |
121 |
Q |
| |
|
||||| ||||||||||||| | |||||||||||| ||||| |||| ||| || |||||||||| ||||||||| || ||||||| ||||||||||||||| |
|
|
| T |
7532094 |
atcgaagtggccgtcgtccaagatttgatggaaatcgtggaaataaatcttcacaaattgatcttggatttcagggtagaaatgctgatgaaactggtag |
7532193 |
T |
 |
| Q |
122 |
agatggtggtcgcagaggcaataaatcttcgcaaattgatcttggatttcagggtagaaattttgatgaaactgatagagatggtggtc |
210 |
Q |
| |
|
||||||||||| | |||||||||||| | | ||||||||||||||||||||| |||||| ||| |||||||| |||||||||||||| |
|
|
| T |
7532194 |
agatggtggtcatcgtggcaataaatctccacgaattgatcttggatttcagggaagaaatgttgctgaaactggtagagatggtggtc |
7532282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 141 - 215
Target Start/End: Original strand, 7532135 - 7532209
Alignment:
| Q |
141 |
aataaatcttcgcaaattgatcttggatttcagggtagaaattttgatgaaactgatagagatggtggtcgtcgt |
215 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||| ||||||||||| |||||||||||||| |||| |
|
|
| T |
7532135 |
aataaatcttcacaaattgatcttggatttcagggtagaaatgctgatgaaactggtagagatggtggtcatcgt |
7532209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University