View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20262_low_146 (Length: 208)
Name: NF20262_low_146
Description: NF20262
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20262_low_146 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 168; Significance: 3e-90; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 14 - 189
Target Start/End: Complemental strand, 38962071 - 38961896
Alignment:
| Q |
14 |
gagatgaaattttaaaaatttgggacagattttagagatggaaataaaattttcatctttgaaggctttagcgacgataaaaataacgacaaaccttgtt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
38962071 |
gagatgaaattttaaaaatttgggacagattttagagacggaaataaaattttcatctttgaaggctttagtgacgataaaaataacgacaaaccttgtt |
38961972 |
T |
|
| Q |
114 |
ccgtctctaattatgtctcagacctatttagagacaaattttgcccgtctatattcccaatttttctaatagtgat |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38961971 |
ccgtctctaattatgtctcagacctatttagagacaaattttgcccgtctatattcccaatttttctaatagtgat |
38961896 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 140 - 187
Target Start/End: Original strand, 14458679 - 14458726
Alignment:
| Q |
140 |
tttagagacaaattttgcccgtctatattcccaatttttctaatagtg |
187 |
Q |
| |
|
||||||||| ||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
14458679 |
tttagagacggattttgcccgtctttattcccaatttttctagtagtg |
14458726 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 140 - 181
Target Start/End: Original strand, 28937484 - 28937525
Alignment:
| Q |
140 |
tttagagacaaattttgcccgtctatattcccaatttttcta |
181 |
Q |
| |
|
||||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
28937484 |
tttagagacggattttgcccgtctctattcccaatttttcta |
28937525 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 140 - 188
Target Start/End: Complemental strand, 7471002 - 7470954
Alignment:
| Q |
140 |
tttagagacaaattttgcccgtctatattcccaatttttctaatagtga |
188 |
Q |
| |
|
||||||||| ||||||||||||| |||||||||||||| || |||||| |
|
|
| T |
7471002 |
tttagagacggattttgcccgtctctattcccaatttttgtagtagtga |
7470954 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 81 - 125
Target Start/End: Original strand, 43562672 - 43562716
Alignment:
| Q |
81 |
ttagcgacgataaaaataacgacaaaccttgttccgtctctaatt |
125 |
Q |
| |
|
|||||||| | ||||| |||||||||||||||||| ||||||||| |
|
|
| T |
43562672 |
ttagcgaccacaaaaacaacgacaaaccttgttccatctctaatt |
43562716 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University