View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20262_low_15 (Length: 622)
Name: NF20262_low_15
Description: NF20262
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20262_low_15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 95; Significance: 4e-46; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 95; E-Value: 4e-46
Query Start/End: Original strand, 480 - 606
Target Start/End: Original strand, 9651755 - 9651881
Alignment:
| Q |
480 |
tatatatacgatgtgaaatgtactatcaatctactaagattgtactgcattacagttacgtgtactgcaagtattagggaattgtactatactatgatta |
579 |
Q |
| |
|
||||||||| ||||||| |||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
9651755 |
tatatatacaatgtgaattgtactatcaatctactaagattgtactacattacagttacttgtactgcaagtattagaggattgtactatactatgatta |
9651854 |
T |
|
| Q |
580 |
cttctactgtaagtaacagatgtctct |
606 |
Q |
| |
|
||||| ||||||||||||| ||||||| |
|
|
| T |
9651855 |
cttctgctgtaagtaacaggtgtctct |
9651881 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 46; Significance: 6e-17; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 479 - 596
Target Start/End: Complemental strand, 22190746 - 22190629
Alignment:
| Q |
479 |
atatatatacgatgtgaaatgtactatcaatctactaagattgtactgcattacagttacgtgtactgcaagtattagggaattgtactatactatgatt |
578 |
Q |
| |
|
|||||||| | | ||||| |||||||||||||||||||||||||||| |||| ||||| | ||||||||||||| || |||||||||| |||| || |
|
|
| T |
22190746 |
atatatattcaaagtgaattgtactatcaatctactaagattgtactacattgcagttgcttgtactgcaagtaagtggaaattgtactacactacagtt |
22190647 |
T |
|
| Q |
579 |
acttctactgtaagtaac |
596 |
Q |
| |
|
||||||||| ||||||| |
|
|
| T |
22190646 |
acttctactacaagtaac |
22190629 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 437 - 482
Target Start/End: Complemental strand, 22190850 - 22190805
Alignment:
| Q |
437 |
ggatcgtaacaaactctctcttcaaagagaacttatgataccatat |
482 |
Q |
| |
|
|||||||||||||||||||||||||||||| || ||||||||||| |
|
|
| T |
22190850 |
ggatcgtaacaaactctctcttcaaagagagctactgataccatat |
22190805 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000009; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 166 - 206
Target Start/End: Original strand, 41059455 - 41059495
Alignment:
| Q |
166 |
tgtagtttagaaattaaatgggttagtgctagtgatttttt |
206 |
Q |
| |
|
||||||||||||||||||||||||||| | |||| |||||| |
|
|
| T |
41059455 |
tgtagtttagaaattaaatgggttagtccaagtggtttttt |
41059495 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University