View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20262_low_66 (Length: 373)
Name: NF20262_low_66
Description: NF20262
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20262_low_66 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 223; Significance: 1e-123; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 140 - 362
Target Start/End: Complemental strand, 43900246 - 43900024
Alignment:
| Q |
140 |
tgcaatttggtgttaagaaaatgaatacagtattatcctttttctgtttggattttaagatcttcagttgattgatatgaaaagctaaaactaagcttag |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43900246 |
tgcaatttggtgttaagaaaatgaatacagtattatcctttttctgtttggattttaagatcttcagttgattgatatgaaaagctaaaactaagcttag |
43900147 |
T |
 |
| Q |
240 |
actctcaacctttgccaatgtaaaaatgtatgagattttgaaaaatgtgattattattaggcgactagtgataattagttatcaattcttctcgaaattt |
339 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43900146 |
actctcaacctttgccaatgtaaaaatgtatgagattttgaaaaatgtgattattattaggcgactagtgataattagttatcaattcttctcgaaattt |
43900047 |
T |
 |
| Q |
340 |
gactggaattatgatttaatatt |
362 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
43900046 |
gactggaattatgatttaatatt |
43900024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 17 - 75
Target Start/End: Complemental strand, 43900409 - 43900351
Alignment:
| Q |
17 |
taattaaatgcacaaaaatgcatagattcactaatgaaaaatgccgtccgtggggtatc |
75 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43900409 |
taattaaatgcacaaaaatacatagattcactaatgaaaaatgccgtccgtggggtatc |
43900351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University