View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20262_low_69 (Length: 370)
Name: NF20262_low_69
Description: NF20262
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20262_low_69 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 183; Significance: 6e-99; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 183; E-Value: 6e-99
Query Start/End: Original strand, 176 - 370
Target Start/End: Complemental strand, 2359371 - 2359177
Alignment:
| Q |
176 |
tgcaaccgtattttggacagcggaagcggacactatagtgcaactgcggttgttgactgtgattgttgattattcttcaccgcgatgactgttgattaaa |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
2359371 |
tgcaaccgtattttggacagcggaagcggacactatagtgcaactgcggttgttgactgtgattgttgattattcttcaccacgatgactattgattaaa |
2359272 |
T |
|
| Q |
276 |
gtaaagacacttcaacgactgagtaagtgatgtcaaaaggtgcattgagaaatatttcagaatgagaaagtgtatttttatttttgcagtggagc |
370 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2359271 |
gtaaagacacttcaacgactgagtaagtgatgtcaaaaggtgcattgaggaatatttcagaatgagaaagtgtatttttatttttgcagtggagc |
2359177 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 18 - 109
Target Start/End: Complemental strand, 2359530 - 2359438
Alignment:
| Q |
18 |
agcaaattcacatcttt-acataataaggtcttagttttatgtatgtttgatgcttcttaacacttgtgatgttgtttccgcccatagtaagt |
109 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2359530 |
agcaaattcacatcttttacataataaggtcttagttttatgtatgtttgatgcttcttaacacttgtgatgttgtttccgcccatagtaagt |
2359438 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University