View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20262_low_90 (Length: 308)
Name: NF20262_low_90
Description: NF20262
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20262_low_90 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 171; Significance: 8e-92; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 171; E-Value: 8e-92
Query Start/End: Original strand, 25 - 203
Target Start/End: Complemental strand, 38999964 - 38999786
Alignment:
| Q |
25 |
ttgcttgttcctcaattcatggattgatcaaacaaatgtcttcaatctacatgttaatctagtagtatacataatggattgatcgaacatcatgttatca |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38999964 |
ttgcttgttcctcaattcatggattgatcaaacaaatgtcttcaacctacatgttaatctagtagtatacataatggattgatcgaacatcatgttatca |
38999865 |
T |
 |
| Q |
125 |
ttcattctactaggtgagaatactcttttcatgttcttaagtcctttacatattttctctctttccattgatttgtagc |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38999864 |
ttcattctactaggtgagaatactcttttcatgttctttagtcctttacatattttctctctttccattgatttgtagc |
38999786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University