View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20263_high_6 (Length: 244)
Name: NF20263_high_6
Description: NF20263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20263_high_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 138; Significance: 3e-72; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 8 - 169
Target Start/End: Complemental strand, 48536770 - 48536609
Alignment:
| Q |
8 |
cagggggtggctcagcgctgactatcaatatcaaagttgaacacaagtttactgtagagttggcggatccggtgatcgttgtcgctgcagattcgacaaa |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||| ||||||||||||||||||||| || |
|
|
| T |
48536770 |
cagggggtggctcagcgctgactatcaatatcaaagttgaacacaagtttacggtagagttggcggatctggtgaccgttgtcgctgcagattcgacgaa |
48536671 |
T |
 |
| Q |
108 |
agcgccgagcatcgatgttgaggataagcctactctagagtcgacggatctagaatgagtga |
169 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
48536670 |
agcgccgagcatcgatgttgaggataagcctactctagagtcggcggatctagagtgagtga |
48536609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 50 - 131
Target Start/End: Complemental strand, 48533752 - 48533671
Alignment:
| Q |
50 |
acaagtttactgtagagttggcggatccggtgatcgttgtcgctgcagattcgacaaaagcgccgagcatcgatgttgagga |
131 |
Q |
| |
|
||||||||||| |||||||| | ||||||| || || |||||||||||||||||| |||||||||||||| |||| ||||| |
|
|
| T |
48533752 |
acaagtttactctagagttgccagatccggcgaccgctgtcgctgcagattcgacggaagcgccgagcatcaatgtcgagga |
48533671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University