View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20263_low_3 (Length: 282)
Name: NF20263_low_3
Description: NF20263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20263_low_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 158; Significance: 4e-84; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 84 - 265
Target Start/End: Complemental strand, 45683116 - 45682935
Alignment:
| Q |
84 |
aaacaatatctatcaaatcatatcatcatatatctctattttactaatttcctctttcctaaagcaaattcgagtaatttagtaatgggcctctgtacta |
183 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
45683116 |
aaacaagatctatcaaatcatatcatcatatatctctattttactaatttcctctttcctaaagcaaattcgactaatttagtaatgggcctctgtacta |
45683017 |
T |
 |
| Q |
184 |
tcctccacaattgacatctctcgagcagttcagctttatttcatgaattctgctctataaccaacaattattgctcgctttc |
265 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||| || |||| ||||||||||||||||| |
|
|
| T |
45683016 |
tcctccacaattgacatctctcaagcagttcagctttatttcatgaattctgctctttacccaataattattgctcgctttc |
45682935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 17 - 89
Target Start/End: Complemental strand, 45683580 - 45683508
Alignment:
| Q |
17 |
tactacaataaattatactcctcctcccttggattccctctcatattcactcttgcttattaacactaaacaa |
89 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45683580 |
tactacaataaattatactcctcctcccttggattccctctcatattcactcttgcttattaacactaaacaa |
45683508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University