View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20263_low_6 (Length: 244)

Name: NF20263_low_6
Description: NF20263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20263_low_6
NF20263_low_6
[»] chr3 (2 HSPs)
chr3 (8-169)||(48536609-48536770)
chr3 (50-131)||(48533671-48533752)


Alignment Details
Target: chr3 (Bit Score: 138; Significance: 3e-72; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 8 - 169
Target Start/End: Complemental strand, 48536770 - 48536609
Alignment:
8 cagggggtggctcagcgctgactatcaatatcaaagttgaacacaagtttactgtagagttggcggatccggtgatcgttgtcgctgcagattcgacaaa 107  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||| ||||||||||||||||||||| ||    
48536770 cagggggtggctcagcgctgactatcaatatcaaagttgaacacaagtttacggtagagttggcggatctggtgaccgttgtcgctgcagattcgacgaa 48536671  T
108 agcgccgagcatcgatgttgaggataagcctactctagagtcgacggatctagaatgagtga 169  Q
    ||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||    
48536670 agcgccgagcatcgatgttgaggataagcctactctagagtcggcggatctagagtgagtga 48536609  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 50 - 131
Target Start/End: Complemental strand, 48533752 - 48533671
Alignment:
50 acaagtttactgtagagttggcggatccggtgatcgttgtcgctgcagattcgacaaaagcgccgagcatcgatgttgagga 131  Q
    ||||||||||| |||||||| | ||||||| || || ||||||||||||||||||  |||||||||||||| |||| |||||    
48533752 acaagtttactctagagttgccagatccggcgaccgctgtcgctgcagattcgacggaagcgccgagcatcaatgtcgagga 48533671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University