View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20263_low_7 (Length: 237)
Name: NF20263_low_7
Description: NF20263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20263_low_7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 14 - 218
Target Start/End: Original strand, 23975601 - 23975805
Alignment:
| Q |
14 |
agatgaaggtgaaaccagggatgacatacttactacgaataatcaatgttgcactcaataatcatcttttcttcaaaatagcaaatcacaatttcacagt |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
23975601 |
agatgaaggtgaaaccagggatgacatacttgctacggataatcaatgttgcactcaataacaatcttttcttcaaaatagcaaatcacagtttcacagt |
23975700 |
T |
|
| Q |
114 |
tgttgcactagatgctgactacaccgatccattcaagaccgacgtcatcgttatcgcccctggccaaacggttgatgctttgttcacagcaaaccaacct |
213 |
Q |
| |
|
||||||||| |||||||||||||| |||||||| |||| ||| ||||||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
23975701 |
tgttgcactggatgctgactacacgaatccattcgagactgacatcatcgttatcgcccctggccaaacagttgatgctttgttcacagcaaatcaacct |
23975800 |
T |
|
| Q |
214 |
atagg |
218 |
Q |
| |
|
||||| |
|
|
| T |
23975801 |
atagg |
23975805 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 40 - 116
Target Start/End: Original strand, 6026096 - 6026172
Alignment:
| Q |
40 |
tacttactacgaataatcaatgttgcactcaataatcatcttttcttcaaaatagcaaatcacaatttcacagttgt |
116 |
Q |
| |
|
||||||||||| || ||||||| |||||||||| | || | ||||||||| |||||||| || | |||||||||||| |
|
|
| T |
6026096 |
tacttactacgcattatcaatgctgcactcaatgaacaacatttcttcaagatagcaaaccatagtttcacagttgt |
6026172 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University