View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20264_high_11 (Length: 435)
Name: NF20264_high_11
Description: NF20264
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20264_high_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 19 - 73
Target Start/End: Original strand, 41104713 - 41104762
Alignment:
| Q |
19 |
aatccttcccttgcaattgaatagactaatcattatatttgaaccaaatagtatt |
73 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
41104713 |
aatccttcccttgcaattgaatagactaatc-----atttgaaccaaatagtatt |
41104762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University