View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20264_high_15 (Length: 348)
Name: NF20264_high_15
Description: NF20264
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20264_high_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 105; Significance: 2e-52; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 131 - 332
Target Start/End: Original strand, 11814897 - 11815098
Alignment:
| Q |
131 |
acgttggaaaatacaaatgtgtagtatgtttgtaacttttgcaagccaaatgtttattatatagatataaaatacagttatagatctttatttaggcgtt |
230 |
Q |
| |
|
||||||||||||| | |||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||| |
|
|
| T |
11814897 |
acgttggaaaataaacttgtgtagtatctttgtaacttttgcaagccaaatgtttattatat-gatataaaatacagttatagatttttatttaggcgtt |
11814995 |
T |
 |
| Q |
231 |
tgtcggggtaggttcctgcccccatatttgccnnnnnnnnnnnnnncagaat-cccaaagcaaacgaaaacaatgtaaacaaaatatataattaataagg |
329 |
Q |
| |
|
| || |||||| |||||||||||||||||||| |||||| ||||||||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
11814996 |
tctcagggtagtttcctgcccccatatttgccaaaaaagaaaaaaacagaatccccaaagcaaacgaaaacaatctaaataaaatatataattaataagg |
11815095 |
T |
 |
| Q |
330 |
tct |
332 |
Q |
| |
|
||| |
|
|
| T |
11815096 |
tct |
11815098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University