View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20264_high_24 (Length: 302)
Name: NF20264_high_24
Description: NF20264
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20264_high_24 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 153; Significance: 4e-81; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 18 - 174
Target Start/End: Original strand, 39853255 - 39853411
Alignment:
| Q |
18 |
ctaacaacaagtctagaattggtgttccttgtagtagggtacatcaccatgttcattctagatactaataaatttgtgtttgtgttgcctgaaacattat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39853255 |
ctaacaacaagtctagaattggtgttccttgtagtagggtacatcaccatgttcattctagatactaataaatttgtgtttgtgttgcctgaaacattat |
39853354 |
T |
 |
| Q |
118 |
taggtgaccacacaaaccctgaagctgcagatgccatgttgcaactagccatgatac |
174 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39853355 |
taggtgacaacacaaaccctgaagctgcagatgccatgttgcaactagccatgatac |
39853411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University