View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20264_high_31 (Length: 255)
Name: NF20264_high_31
Description: NF20264
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20264_high_31 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 103; Significance: 2e-51; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 109 - 236
Target Start/End: Original strand, 7426831 - 7426958
Alignment:
| Q |
109 |
catgagagaattggcctaaatctcaaaagagaatattggcnnnnnnnattttcccaattgatctagtgaatggtgatttcctgcttgatgagtggatgac |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7426831 |
catgagagaattggcctaaatctcaaaagagaatattggctttttttattttcccaattgatctagtgaatggtgatttcctgcttgatgagtggatgac |
7426930 |
T |
 |
| Q |
209 |
ttctctttaacaatactcatattcatac |
236 |
Q |
| |
|
|||||||||||||||||| ||||||||| |
|
|
| T |
7426931 |
ttctctttaacaatactcgtattcatac |
7426958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 13 - 59
Target Start/End: Original strand, 7426735 - 7426781
Alignment:
| Q |
13 |
cagagagtatgaaaaagagttgtcacaaaataacggtacaaatatca |
59 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
7426735 |
cagagagtatgaaaaagagttgtcacaaaataacggtacaactatca |
7426781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University