View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20264_high_41 (Length: 205)
Name: NF20264_high_41
Description: NF20264
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20264_high_41 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 16 - 187
Target Start/End: Original strand, 7258082 - 7258253
Alignment:
| Q |
16 |
agaagataaggagaggcaaataatgggtacaagaatactgccgaacctcgtgagcaaaaatattttcctaacttttttatttatatttgggcaaaccaat |
115 |
Q |
| |
|
||||||||||||||||| |||||||||| || |||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
7258082 |
agaagataaggagaggcgaataatgggtgcaggaatactgccgaacctcgtgagcaaaaatattctgctaacttttttatttatatttgggcaaaccaat |
7258181 |
T |
|
| Q |
116 |
gcatgactttatatttgggcaaaccaatgnnnnnnnatggcatgtgcgtcacatgagttcaatagttcttta |
187 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
7258182 |
gcatgactttatatttgggcaaaccaatgttttttgatggcatgtgcgtcacatgagttcaatagttcttta |
7258253 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University