View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20264_high_5 (Length: 559)
Name: NF20264_high_5
Description: NF20264
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20264_high_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 121; Significance: 1e-61; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 121; E-Value: 1e-61
Query Start/End: Original strand, 12 - 154
Target Start/End: Complemental strand, 29306635 - 29306496
Alignment:
| Q |
12 |
gcagagattcagagatcaaaacagcaactgtgatcgcagttgcgttgtaagcctttatattgcggcaaaatgcagacaaatatggccgatgagccacatt |
111 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29306635 |
gcagagattctgagatcaaaacagcaactgtgatcgcagttgcgttgtaagcctttatattgcggcaaaatgcagacaaatatggccgatgagccacatt |
29306536 |
T |
|
| Q |
112 |
tacgccggctggaatactaatgtgaagaactctaaatttttta |
154 |
Q |
| |
|
|| |||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
29306535 |
ta---cggctgcaatactaatgtgaagaactctaaatttttta |
29306496 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 54; E-Value: 9e-22
Query Start/End: Original strand, 475 - 528
Target Start/End: Complemental strand, 29306501 - 29306448
Alignment:
| Q |
475 |
tttttaaaaataaactaatgatcataacacaaacctcaactgaagaataattca |
528 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29306501 |
tttttaaaaataaactaatgatcataacacaaacctcaactgaagaataattca |
29306448 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 480 - 544
Target Start/End: Complemental strand, 29297736 - 29297672
Alignment:
| Q |
480 |
aaaaataaactaatgatcataacacaaacctcaactgaagaataattcacggcaagggaaaaatt |
544 |
Q |
| |
|
|||| ||||||||||| |||||||||||||| ||||||||||||||||| ||||||||||||||| |
|
|
| T |
29297736 |
aaaattaaactaatgagcataacacaaaccttaactgaagaataattcatggcaagggaaaaatt |
29297672 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 389 - 456
Target Start/End: Complemental strand, 29298007 - 29297939
Alignment:
| Q |
389 |
ttgaaagtccattcttattatttactttttct-ggataatttgaaaattctgcatgaagcatgctttgt |
456 |
Q |
| |
|
||||||||||||| | ||||||| ||||| | |||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
29298007 |
ttgaaagtccattatgattatttgtttttttttggataagttgaaaactctgcatgaagcatgctttgt |
29297939 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University