View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20264_low_11 (Length: 452)
Name: NF20264_low_11
Description: NF20264
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20264_low_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 424; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 424; E-Value: 0
Query Start/End: Original strand, 20 - 443
Target Start/End: Complemental strand, 43029631 - 43029208
Alignment:
| Q |
20 |
ttcagcacatgcaattagaagttgaactagtctcattccatcagcacatgaaccatcttcttcagcttcgcaattattgtagttgaagttatcttctgct |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43029631 |
ttcagcacatgcaattagaagttgaactagtctcattccatcagcacatgaaccatcttcttcagcttcgcaattattgtagttgaagttatcttctgct |
43029532 |
T |
|
| Q |
120 |
gcttcttcaacagcttcagaagcaaaatatctttgtttataagttcttatgtgatctctgaaatgaagccttggaatgctattcacactgttgttattgc |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43029531 |
gcttcttcaacagcttcagaagcaaaatatctttgtttataagttcttatgtgatctctgaaatgaagccttggaatgctattcacactgttgttattgc |
43029432 |
T |
|
| Q |
220 |
tgttgatgttattgaagaaactattactatggctgctgaaattagcaaaccaaatagggatagttacggttgatcttttcaatttcttgtgatccctaat |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43029431 |
tgttgatgttattgaagaaactattactatggctgctgaaattagcaaaccaaatagggatagttacggttgatcttttcaatttcttgtgatccctaat |
43029332 |
T |
|
| Q |
320 |
ggtttcagtttcatgatcagaaaatggattaaggatccatgttgaagtagcactgttttctaaaataggcaaatttggatataaagaagcatagtaagaa |
419 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43029331 |
ggtttcagtttcatgatcagaaaatggattaaggatccatgttgaagtagcactgttttctaaaataggcaaatttggatataaagaagcatagtaagaa |
43029232 |
T |
|
| Q |
420 |
cccattaatgatggattttcatct |
443 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
43029231 |
cccattaatgatggattttcatct |
43029208 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University