View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20264_low_30 (Length: 262)
Name: NF20264_low_30
Description: NF20264
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20264_low_30 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 28 - 253
Target Start/End: Original strand, 28515871 - 28516095
Alignment:
| Q |
28 |
taaaatagggaatcatgaggagaattcagttatcatatataatcagaagaggtgtggggagaaaggtagcttttggcattcatttgagaagataaatgtt |
127 |
Q |
| |
|
|||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
28515871 |
taaattagggaatcatgtggagaattcagttatcatatataatcagaagaggtgtggggagaaaggtagcttttggcattcatttgagaagataa-tgtt |
28515969 |
T |
|
| Q |
128 |
ttattgtctgcacttgaaatgttttcagcagtagcaatctagcctagaggttattgttgtttgaaacttggaagttccaccttcttcgcccatgatctgt |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
28515970 |
ttattgtctgcacttgaaatgttttcagcagtagcaatctagcctagaggatatcgttgtttgaaacttggaagttccaccttcttcgcgcatgatctgt |
28516069 |
T |
|
| Q |
228 |
actttttgtcgccctctgtgctgctc |
253 |
Q |
| |
|
||||||||||||||| |||||||||| |
|
|
| T |
28516070 |
actttttgtcgccctttgtgctgctc |
28516095 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University