View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20264_low_35 (Length: 244)
Name: NF20264_low_35
Description: NF20264
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20264_low_35 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 1 - 230
Target Start/End: Original strand, 6684792 - 6685020
Alignment:
| Q |
1 |
aagtgattttgcaaatgcgattctaaacatgaatgaatctagaatttattttagctatcaatatctgctcgaattctccttctgttgcccatgctttctc |
100 |
Q |
| |
|
|||||||| |||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
6684792 |
aagtgattctgcaaatgcgattccaaacatgaatgaatctagaatttattttcgctatcaatatctgctcgaattctccttctgttgcc-atgctttctc |
6684890 |
T |
|
| Q |
101 |
aattgcaattgaatgaatggaaagctnnnnnnntgaaacacttcgagattgacttattccagaatgcttttatgaaaacatgattttgtaacgcaatttg |
200 |
Q |
| |
|
|||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
6684891 |
aattgcaactgaatgaatggaaagctagcaaaatgaaacacttcgagattgacttattccagaatgcgtttatgaaaacatgattttgtaacgcaatttg |
6684990 |
T |
|
| Q |
201 |
gaaaatgtgatgctggaaaagtaatttatg |
230 |
Q |
| |
|
||||||| |||| ||||||| ||||||||| |
|
|
| T |
6684991 |
gaaaatgcgatgttggaaaaataatttatg |
6685020 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University