View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20264_low_37 (Length: 231)
Name: NF20264_low_37
Description: NF20264
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20264_low_37 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 1 - 132
Target Start/End: Complemental strand, 37178179 - 37178048
Alignment:
| Q |
1 |
ggaatcaggggaggctggtatgtcaatttccaactattcaaatcaagtggttaggcagaatacatttaaagaaagtatccgtggagaaagggagcctaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37178179 |
ggaatcaggggaggctggtatgtcaatttccaactattcaaatcaagtggttaggcagaatacatttaaagaaagtatccgtggagaaagggagcctaat |
37178080 |
T |
|
| Q |
101 |
tatgacaattttgtttcaaggtctggatgttc |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
37178079 |
tatgacaattttgtttcaaggtctggatgttc |
37178048 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 127 - 213
Target Start/End: Complemental strand, 37173525 - 37173439
Alignment:
| Q |
127 |
atgttcatccccgtctttgtcttcctggctcaaactgactgacttggttgccagaattgattctgaaacaccaattgaatccgaaga |
213 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37173525 |
atgttcatccccatctttgtcttcctggctcaaactgactgacttggttgccagaattgattctgaaacaccaattgaatccgaaga |
37173439 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University