View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20265_high_10 (Length: 282)
Name: NF20265_high_10
Description: NF20265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20265_high_10 |
 | |
|
| [»] scaffold0280 (1 HSPs) |
| | |
|
Alignment Details
Target: chr2 (Bit Score: 187; Significance: 1e-101; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 18 - 272
Target Start/End: Complemental strand, 37800809 - 37800555
Alignment:
| Q |
18 |
cagccaagaggacaatgtgaggtttatgctttctgcggtgcatttgggagctgcaatgaaaactcaaagccttattgtagttgtttgagaggttttgagc |
117 |
Q |
| |
|
|||||||||| ||||||||| |||||||||||||||||||||||||||||||| || |||| || | ||||||||||||||||||||||||||| |||| |
|
|
| T |
37800809 |
cagccaagagtacaatgtgatgtttatgctttctgcggtgcatttgggagctgttatcaaaattccatgccttattgtagttgtttgagaggtttcgagc |
37800710 |
T |
|
| Q |
118 |
caaaatcggtgtctgaatggaatctgggggataagtcaggtgggtgtgttaggaaaacaagtttgcaatgtgagagatcaaatccctcttatagggataa |
217 |
Q |
| |
|
|||| || |||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
37800709 |
caaagtcagtgtctgaatggaatctgggggataactcaggtggatgtgttaggaaaacaagtttgcaatgtgagggatccaatccctcttatagggataa |
37800610 |
T |
|
| Q |
218 |
tgacgcgttccttgcaatcccaaacatggcattacctaaatatgcacaatctgtg |
272 |
Q |
| |
|
||||||||||||||||||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
37800609 |
tgacgcgttccttgcaatcccaaacattgcatcacctaaatatgcacaatctgtg |
37800555 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 18 - 263
Target Start/End: Original strand, 37764943 - 37765188
Alignment:
| Q |
18 |
cagccaagaggacaatgtgaggtttatgctttctgcggtgcatttgggagctgcaatgaaaactcaaagccttattgtagttgtttgagaggttttgagc |
117 |
Q |
| |
|
||||||||| ||| ||||||| ||||||||| |||||| | ||||||||||| | ||||||||||||||| ||||||| ||||||||| |||| ||||| |
|
|
| T |
37764943 |
cagccaagacaacattgtgaggcttatgctttatgcggttcgtttgggagctgtactgaaaactcaaagccgtattgtaattgtttgagtggttatgagc |
37765042 |
T |
|
| Q |
118 |
caaaatcggtgtctgaatggaatctgggggataagtcaggtgggtgtgttaggaaaacaagtttgcaatgtgagagatcaaatccctcttatagggataa |
217 |
Q |
| |
|
|||| || |||||| ||| || ||| |||| | ||||| |||||| | || |||||||| || ||||| ||||| || || |||| || ||| || |
|
|
| T |
37765043 |
caaagtcacagtctgactgggatttggaggatcactcaggcgggtgtctgagaaaaacaaggttacaatgcgagagttctggtcactctaatggggtaaa |
37765142 |
T |
|
| Q |
218 |
tgacgcgttccttgcaatcccaaacatggcattacctaaatatgca |
263 |
Q |
| |
|
||| ||||| ||||||||| ||||||||||| |||||| ||||| |
|
|
| T |
37765143 |
ggacaggttccgtgcaatccccaacatggcattgcctaaacatgca |
37765188 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0280 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: scaffold0280
Description:
Target: scaffold0280; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 15 - 88
Target Start/End: Original strand, 15134 - 15207
Alignment:
| Q |
15 |
tcacagccaagaggacaatgtgaggtttatgctttctgcggtgcatttgggagctgcaatgaaaactcaaagcc |
88 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| ||||||||||| ||||| ||| | ||||||||||| |
|
|
| T |
15134 |
tcacagccaagaggacagtgtgaggtttatgctttctgtggtgcatttggtagctgtaatcagaactcaaagcc |
15207 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 29 - 121
Target Start/End: Complemental strand, 6433518 - 6433426
Alignment:
| Q |
29 |
acaatgtgaggtttatgctttctgcggtgcatttgggagctgcaatgaaaactcaaagccttattgtagttgtttgagaggttttgagccaaa |
121 |
Q |
| |
|
|||||||||| |||||||||| |||||| | ||||||||||||| ||| ||||| ||||| ||||||| |||||| || |||| ||||||||| |
|
|
| T |
6433518 |
acaatgtgagatttatgctttgtgcggttcgtttgggagctgcactgagaactcgaagccatattgtaattgtttcagtggttgtgagccaaa |
6433426 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University