View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20265_high_11 (Length: 263)
Name: NF20265_high_11
Description: NF20265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20265_high_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 215; Significance: 1e-118; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 19 - 261
Target Start/End: Original strand, 37800334 - 37800576
Alignment:
| Q |
19 |
ataatcaaccttgcctgattactgtttttactagcatcgcgtaattctgaagctgcaagtttgacacattaagtttttcgacttctatcatcagaagcca |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||| || ||||||||||||| ||||||||||||| || |
|
|
| T |
37800334 |
ataatcaaccttgcctgattactgtttttactagcatcacgtaattctgatgctgcaagtttgacatataaagtttttcgactactatcatcagaagtca |
37800433 |
T |
 |
| Q |
119 |
attgttgcagattaatgaggtctcctacccaaattgaacatccattactatcatatgcataagcagtgcatgaacagttttttaagcaagttaattcaca |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
37800434 |
attgttgcagattaatgaggtctcctacccaaattgaacatccattactatcatatgcataagcagtgcatgaacagtttttcaagcaagttaattcaca |
37800533 |
T |
 |
| Q |
219 |
ttcagctgcattccctagccccacagattgtgcatatttaggt |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37800534 |
ttcagctgcattccctagccccacagattgtgcatatttaggt |
37800576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 61 - 184
Target Start/End: Complemental strand, 37765376 - 37765253
Alignment:
| Q |
61 |
aattctgaagctgcaagtttgacacattaagtttttcgacttctatcatcagaagccaattgttgcagattaatgaggtctcctacccaaattgaacatc |
160 |
Q |
| |
|
|||||||| ||||||||||| | | | | ||||||| ||| |||||||| |||| || ||||||||||| | ||||||| | | ||||||||||||| |
|
|
| T |
37765376 |
aattctgatgctgcaagttttagatacaatgtttttccactactatcatctgaaggtaactgttgcagatttaggaggtcttcaatccaaattgaacatt |
37765277 |
T |
 |
| Q |
161 |
cattactatcatatgcataagcag |
184 |
Q |
| |
|
||||||||||||||| |||||||| |
|
|
| T |
37765276 |
cattactatcatatgaataagcag |
37765253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University