View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20265_high_6 (Length: 453)
Name: NF20265_high_6
Description: NF20265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20265_high_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 206; Significance: 1e-112; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 196 - 442
Target Start/End: Complemental strand, 42357192 - 42356942
Alignment:
| Q |
196 |
gagttgtattgtacaacctacatacttgtcacgcatacaagataagagtaattaacaatatttagaataatgtttaagtgcatgactgagattatatttt |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42357192 |
gagttgtattgtacaacctacatacttgtcacgcatacaagataagagtaattaacaatatttagaataatgtttaagtgcatgactgagattatatttt |
42357093 |
T |
 |
| Q |
296 |
tccttagttgtagtagtattatatcactatattattatttgatcaagtacttatatcatcactttaattacttttt-------gcttttggctttctctg |
388 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
42357092 |
tccttagttatagtagtattatatcactatattattatttgatcaagtacttat---atcactttaattactttttgcttttggcttttggctttctctg |
42356996 |
T |
 |
| Q |
389 |
tatatatctgtgtgccagggaaagacacgaaagagatcatatcatactgccttt |
442 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42356995 |
tatatatatgtgtgccagggaaagacacgaaagagatcatatcatactgccttt |
42356942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 79 - 163
Target Start/End: Complemental strand, 42357308 - 42357225
Alignment:
| Q |
79 |
gaaaagtggtccttccttggtcaccagtgctgtcccttactggggagggtgataactgcacatagaaacagaaataatcaacaac |
163 |
Q |
| |
|
||||||||||| |||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42357308 |
gaaaagtggtc-ttccttcgtcaccagtgctgtcccttacttgggagggtgataactgcacatagaaacagaaataatcaacaac |
42357225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University