View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20265_low_9 (Length: 309)
Name: NF20265_low_9
Description: NF20265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20265_low_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 1 - 304
Target Start/End: Complemental strand, 24573085 - 24572782
Alignment:
| Q |
1 |
aaactttttcaagtgtttcatttcgaggcgacacgagcactttcccggcatttcctcccatctcttggaaattctcaattattttctctggatcttcgtg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24573085 |
aaactttttcaagtgtttcatttcgaggcgacacgagcactttcccggcatttcctcccatctcttggaaattctcaattattttctctggatcttcgtg |
24572986 |
T |
 |
| Q |
101 |
accaccgttgttctcaaatgccccttcaattcttgatgcaatcacccacatgcctttccttcaatgatcaatttttaaaattattttactcacaattaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24572985 |
accaccgttgttctcaaatgccccttcaattcttgatgcaatcacccacatgcctttccttcaatgatcaatttttaaaattattttactcacaattaat |
24572886 |
T |
 |
| Q |
201 |
atatctattcatgatgttcacaaatcttagttcaaccgnnnnnnntatcaagattgttatgtcagatgcaatgattaagattcgaacccctgcttcttct |
300 |
Q |
| |
|
|||| ||| |||| |||||||||||||||||||||||| |||||| |||||||||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
24572885 |
atatatatacatggtgttcacaaatcttagttcaaccgaaaaaaatatcaaaattgttatgtcagatgcaatgattgagatttgaacccctgcttcttca |
24572786 |
T |
 |
| Q |
301 |
cact |
304 |
Q |
| |
|
|||| |
|
|
| T |
24572785 |
cact |
24572782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University