View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20267_low_3 (Length: 218)
Name: NF20267_low_3
Description: NF20267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20267_low_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 34 - 206
Target Start/End: Complemental strand, 17875710 - 17875538
Alignment:
| Q |
34 |
acccttttacttactttttagtaggagttgaatgatgaatgagtcagtgagtcaaatagtaccgagttgagttcccatcatccaaattctgcagcttaca |
133 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17875710 |
acccttttacttactttttagtaggagttgaatgatgaatgagtcagtgagtcaaatagtaccgagttgagttcccatcatccaaattctgcagcttaca |
17875611 |
T |
 |
| Q |
134 |
gcttagagttgacactgtgtttgtttgcaaactctatctctctctaacactatttttatgggattctgtgctc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17875610 |
gcttagagttgacactgtgtttgtttgcaacctctatctctctctaacactatttttatgggattctgtgctc |
17875538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University