View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20268_low_8 (Length: 239)
Name: NF20268_low_8
Description: NF20268
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20268_low_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 180; Significance: 2e-97; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 1 - 180
Target Start/End: Complemental strand, 3895224 - 3895045
Alignment:
| Q |
1 |
atactctctccagcattctctgcagcatcctttgttctctcctttgcatcataagcataatctctagccttctctccagcattctcagccttctctgcag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3895224 |
atactctctccagcattctctgcagcatcctttgttctctcctttgcatcataagcataatctctagccttctctccagcattctcagccttctctgcag |
3895125 |
T |
|
| Q |
101 |
ccctatttgttccttctctggctttatcccacacagaacctgctgcttcattggttctgtcttttacctcataagcatag |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3895124 |
ccctatttgttccttctctggctttatcccacacagaacctgctgcttcattggttctgtcttttacctcataagcatag |
3895045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 49 - 143
Target Start/End: Complemental strand, 3895056 - 3894962
Alignment:
| Q |
49 |
tcataagcataatctctagccttctctccagcattctcagccttctctgcagccctatttgttccttctctggctttatcccacacagaacctgc |
143 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||| |||||||||||||| || | |||||||||| ||||||| ||||||| |||||||| |
|
|
| T |
3895056 |
tcataagcatagtctctagctttctctccagcattctctgccttctctgcagctctgtctgttccttctttggctttctcccacattgaacctgc |
3894962 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 28 - 86
Target Start/End: Complemental strand, 3895329 - 3895271
Alignment:
| Q |
28 |
tcctttgttctctcctttgcatcataagcataatctctagccttctctccagcattctc |
86 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||||||||| ||||| |||||| |||| |
|
|
| T |
3895329 |
tccttggttctttcctttgcatcataagcataatctctagctttctccccagcactctc |
3895271 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 5 - 86
Target Start/End: Complemental strand, 3895286 - 3895205
Alignment:
| Q |
5 |
tctctccagcattctctgcagcatcctttgttctctcctttgcatcataagcataatctctagccttctctccagcattctc |
86 |
Q |
| |
|
|||| |||||| |||||||||| ||||||||||| ||||| |||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
3895286 |
tctccccagcactctctgcagcttcctttgttctatccttggcatcataagcatagtctcttatactctctccagcattctc |
3895205 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University