View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20269_high_16 (Length: 254)
Name: NF20269_high_16
Description: NF20269
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20269_high_16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 19 - 239
Target Start/End: Complemental strand, 49280388 - 49280168
Alignment:
| Q |
19 |
aatcagctatggctatagctgatttggtgaaattcaacaaaaatgtttttgttgggttagtttcgatgggtccaacgattaaggctttgatagcaatgtc |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
49280388 |
aatcagctatggctatagctgatttggtgaaattcaacaaaaatgtttttgttgggttagttttgatgggtccaacgattaaggctttgatagcaatgtc |
49280289 |
T |
|
| Q |
119 |
ttctgaatgttcaataaaggttatttctttgcttgttagattaattcgtagtcctttagttgatgaaattttatctaatggaatgattcctaaaattatt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49280288 |
ttctgaatgttcaataaaggttatttctttgcttgttagattaattcgtagtcctttagttgatgaaattttatctaatggaatgattcctaaaattatt |
49280189 |
T |
|
| Q |
219 |
ggttttttgttatcgagtgat |
239 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
49280188 |
ggttttttgttatcgagtgat |
49280168 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University