View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20269_low_12 (Length: 295)
Name: NF20269_low_12
Description: NF20269
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20269_low_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 19 - 287
Target Start/End: Complemental strand, 39128062 - 39127793
Alignment:
| Q |
19 |
tattgagtgtattttcattatgattaagaaattaactgatatgctcttgtttatgatttttgtggttattgattgatgcaattcaatttcaggagaatct |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39128062 |
tattgagtgtattttcattatgattaagaaattaactgatatgctcttgtttatgatttttgtggttattgattgatgcaattcaatttcaggagaatct |
39127963 |
T |
 |
| Q |
119 |
gcactgtaaata-tttatggtgagaaaattctgatacaggaaacaagtaaaggagagtattttgcaatnnnnnnnttaacagggccaattatttaaactt |
217 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
39127962 |
gcactgtaaatattttatggtgagaaaattctgatacaggaaacaagtaaaggagagtattttgcaataaaaaaattaacagggccaattatttaaactt |
39127863 |
T |
 |
| Q |
218 |
tatttatcagtgtgatttcatggctgctcacatttctatgtgtgatactgaatatcttctgacctttgct |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
39127862 |
tatttatcagtgtgatttcatggctgctcacatttctatgtgtgatactgaatatcttttgacctttgct |
39127793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University