View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20269_low_15 (Length: 264)
Name: NF20269_low_15
Description: NF20269
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20269_low_15 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 91; Significance: 4e-44; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 23 - 117
Target Start/End: Complemental strand, 642560 - 642466
Alignment:
| Q |
23 |
atctcaaaaggttagaaattcaatgtttcttttgaactcttatagtactatttatatgatctagatccaacttcattaatttcttatgtttcacc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
642560 |
atctcaaaaggttagaaattcaatgtttcttttgaactcttatagtactatttatatgatctagatccaacttcatgaatttcttatgtttcacc |
642466 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 177 - 250
Target Start/End: Complemental strand, 642406 - 642334
Alignment:
| Q |
177 |
catcacccttttcagcattgtattgcatggttattgnnnnnnnctggtaaagttcaaattttgcatgttgtttt |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
642406 |
catcacccttttcagcattgtattgcatggttattg-ttttttctggtaaagttcaaattttgcatgttgtttt |
642334 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University