View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20269_low_17 (Length: 255)
Name: NF20269_low_17
Description: NF20269
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20269_low_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 17 - 240
Target Start/End: Complemental strand, 36282368 - 36282145
Alignment:
| Q |
17 |
attttcaaatataataatcgtattaggataggagggagtaaagcgtcaatgtggtggaaggatttgtgtgattggtgcaggggagtcgggtggtgaggaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||| ||||||||| | |
|
|
| T |
36282368 |
attttcaaatataataatcgtattaggagaggagggagtaaagcgtcaatgtggtggaaggatttgtgtgcttggtgaaggggagtcaagtggtgaggga |
36282269 |
T |
 |
| Q |
117 |
agttggtttaaagaagggattagttgcaatttggatgacgaagagactactttattctagaatgatccttgattggagggagggtgtttatgatgtaggt |
216 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
36282268 |
aattggtttaaagaagggattagttgcaatttggatgacgaagaaactactttattctagaatgatccttgattggagggagggtgtttatggtgtaggt |
36282169 |
T |
 |
| Q |
217 |
ttagatgactatttgagctctgtg |
240 |
Q |
| |
|
||| ||||||||||||||| |||| |
|
|
| T |
36282168 |
ttacatgactatttgagctttgtg |
36282145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University