View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2026_high_7 (Length: 243)
Name: NF2026_high_7
Description: NF2026
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2026_high_7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 19 - 229
Target Start/End: Complemental strand, 44066622 - 44066411
Alignment:
| Q |
19 |
ggtataagagctcaacgaataaatatctta-catttgagaatagagagcactgaatagtacagcacatcccaattaacatggaaaaatcaaaatgctcaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44066622 |
ggtataagagctcaacgaataaatatcttaacatttgagaatagagagcactgaatagtacagcacatcccaattaacatggaaaaatcaaaatgctcaa |
44066523 |
T |
|
| Q |
118 |
aaatttgcatatgtatacttctatacattctagctcatagacttatcagatacaactgatggctgtccaagaaaaaattaccatgccagcattcatccac |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44066522 |
aaatttgcatatgtatacttctatacattctagctcatagacttatcagatacaactgatggctgtccaagaaaaaattaccatgccagcattcatccac |
44066423 |
T |
|
| Q |
218 |
actatatctgtg |
229 |
Q |
| |
|
||||||||||| |
|
|
| T |
44066422 |
gctatatctgtg |
44066411 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University