View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2026_low_11 (Length: 286)
Name: NF2026_low_11
Description: NF2026
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2026_low_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 25 - 271
Target Start/End: Original strand, 52513106 - 52513351
Alignment:
| Q |
25 |
ttggtcttggagatgatggagatttgtagattccataatgataaaaatttataattgcatatactaattaagttgttaattaaaaggaaaaatgaagagg |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52513106 |
ttggtcttggagatgatggagatttgtagattccataatgataaaa-tttataattgcatatactaattaagttgttaattaaaaggaaaaatgaagagg |
52513204 |
T |
|
| Q |
125 |
atcaagctaaaggtgttggttgaaaatcccaagatgagtattagctagcaataaggtatagaagtgaatggaatctctagtacagtattgaaaggaacac |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52513205 |
atcaagctaaaggtgttggttgaaaatcccaagatgagtattagctagcaataaggtatagaagtgaatggaatctctagtacagtattgaaaggaacac |
52513304 |
T |
|
| Q |
225 |
agttccaggtgacacccacatacctcggttttttgcccccacttttt |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
52513305 |
agttccaggtgacacccacatacctcggttctttgcccccacttttt |
52513351 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University