View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2026_low_8 (Length: 305)
Name: NF2026_low_8
Description: NF2026
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2026_low_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 115; Significance: 2e-58; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 11 - 221
Target Start/End: Original strand, 41482966 - 41483182
Alignment:
| Q |
11 |
gaagaagaagaagaggaaacatgtaagtactttgtcgtttctactgattaactttttatgttttgatac----------------taaaaattgatgaaa |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||| | ||||||||||||||||| ||||||||||||||| |
|
|
| T |
41482966 |
gaagaagaagaagaggaaacatgtaagtactttgtcgtttcttctgatttagtttttatgttttgatacaagtcagctttgctactaaaaattgatgaaa |
41483065 |
T |
|
| Q |
95 |
ttaattactggattgaaaattcaaatcaactcttaacaactcttaacaactcttagcaactatatatatcaactttgaaattttcaatacaagaaaccct |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41483066 |
ttaattactggattgaaaattcaaatcaacgattaa----------caactcttagcaactatatatatcaactttgaaattttcaatacaagaaaccct |
41483155 |
T |
|
| Q |
195 |
aattgacatagaaatccctaatcctcc |
221 |
Q |
| |
|
|||||||||||||||||||||| |||| |
|
|
| T |
41483156 |
aattgacatagaaatccctaattctcc |
41483182 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 47; Significance: 8e-18; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 81 - 139
Target Start/End: Complemental strand, 53329052 - 53328994
Alignment:
| Q |
81 |
aaaaattgatgaaattaattactggattgaaaattcaaatcaactcttaacaactctta |
139 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
53329052 |
aaaaattcatgaaattaattactggattgaaaattcaaatcaacgtttaacaactctta |
53328994 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 155 - 196
Target Start/End: Complemental strand, 53328943 - 53328902
Alignment:
| Q |
155 |
tatatatatcaactttgaaattttcaatacaagaaaccctaa |
196 |
Q |
| |
|
|||||||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
53328943 |
tatatatatcaaatttgaaaatttcaatacaagaaaccctaa |
53328902 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University