View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20270_high_24 (Length: 253)
Name: NF20270_high_24
Description: NF20270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20270_high_24 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 85; Significance: 1e-40; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 17 - 145
Target Start/End: Original strand, 32870692 - 32870820
Alignment:
| Q |
17 |
agcatgtgctgcagcttgcacgcgccagtcatcagtgcatcgaccaaagatgagccaggtaatgtgaagaatttgttttatcgtttaccccacctgttca |
116 |
Q |
| |
|
|||||| ||||||||||||||||| |||||| || | |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| | |
|
|
| T |
32870692 |
agcatgcgctgcagcttgcacgcgtcagtcagcaaaggatcgaccaaagatgagccaggtaatgtgaagaatttgttttatcgtttaccctacctgttta |
32870791 |
T |
 |
| Q |
117 |
ttttcaaccgtcgttcctcttttcaaaaa |
145 |
Q |
| |
|
|||||||| ||| ||| |||||||||||| |
|
|
| T |
32870792 |
ttttcaactgtcattcttcttttcaaaaa |
32870820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 18 - 105
Target Start/End: Original strand, 32903959 - 32904046
Alignment:
| Q |
18 |
gcatgtgctgcagcttgcacgcgccagtcatcagtgcatcgaccaaagatgagccaggtaatgtgaagaatttgttttatcgtttacc |
105 |
Q |
| |
|
||||| |||||||||||||| || || ||| || || ||||||||||||||||||||||| ||||||| |||||| |||| |||||| |
|
|
| T |
32903959 |
gcatgcgctgcagcttgcacacgtcactcagcaaagcgtcgaccaaagatgagccaggtaaagtgaagagtttgttatatcatttacc |
32904046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 63; Significance: 2e-27; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 148 - 246
Target Start/End: Original strand, 14911567 - 14911664
Alignment:
| Q |
148 |
aaaatgctcaattgcacgactaaaaccatcgtgtgtatcccgcgaatgtgctggcaactgaggtccccactctttttcatacaaaatgctgaaattaac |
246 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||||||||||||||||| | ||||||||||||||| ||||| ||||||||||||||| ||||||||| |
|
|
| T |
14911567 |
aaaatgctcaattgcacgacaaaaatcatcgtgtgtatcccgcgaatgcgttggcaactgaggtcctcactc-ttttcatacaaaatgtcgaaattaac |
14911664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 144 - 234
Target Start/End: Original strand, 42434013 - 42434098
Alignment:
| Q |
144 |
aaggaaaatgctcaattgcacgactaaaaccatcgtgtgtatcccgcgaatgtgctggcaactgaggtccccactctttttcatacaaaat |
234 |
Q |
| |
|
|||| ||||||||||||| |||| |||||||||||| || ||||||| ||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
42434013 |
aagggaaatgctcaattgtgcgacaaaaaccatcgtgcgt-----gcgaatgcgctggcaactgaggtccccactctttttcatgcaaaat |
42434098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University